Tek-Tips is the largest IT community on the Internet today!

Members share and learn making Tek-Tips Forums the best source of peer-reviewed technical information on the Internet!

Register Log in
  • Congratulations Rhinorhino on being selected by the Tek-Tips community for having the most helpful posts in the forums last week. Way to Go!

Search results for query: *

  1. JohnLucania

    Output generation with loop on the fly

    I opt to use the existing modules rather than reinventing wheels. print "writing results"; our $filename; while ( my @rids = $fac->each_rid ) { die "No record found\n" unless @rids; foreach my $rid ( @rids ) { my $result = $fac->retrieve_blast( $rid ); if( ref( $result )) {...
  2. JohnLucania

    Output generation with loop on the fly

    I see. Can you introduce the option 1)? [ponder]
  3. JohnLucania

    Output generation with loop on the fly

    with #use strict; I am getting the one big file still. So, I guess use strict; shouldn't be an issue here. [ponder]
  4. JohnLucania

    Output generation with loop on the fly

    Yes, I have it. #! /usr/bin/perl -w use strict; use warnings; $|++; use Bio::Perl; use Bio::Tools::Run::RemoteBlast; use Bio::Search::Result::ResultI; use Bio::Search::Hit::HitI; use Bio::Search::HSP::HSPI; use Bio::DB::RandomAccessI; use Bio::DB::Query::GenBank; use Bio::DB::GenBank; use...
  5. JohnLucania

    Output generation with loop on the fly

    It still generate one big file only. any ideas? [ponder]
  6. JohnLucania

    Output generation with loop on the fly

    ok, $fac is: my $fac = Bio::Tools::Run::RemoteBlast->new( -prog => 'blastp', -data => 'nr' , -expect => $evalue , -readmethod => 'SearchIO' ); my $gb_dbh = Bio::DB::GenBank->new(-format => 'fasta'); my $str = $gb_dbh->get_Seq_by_acc( $accession ); print...
  7. JohnLucania

    Output generation with loop on the fly

    ...); if( ref( $result )) { my $output = $result->next_result(); my $filename = $output->query_name().".out"; $filename =~ s/.*?\|(\w*).*/$1.out/; $fac->save_output( $filename ); $fac->remove_rid( $rid ); } elsif( $result < 0 ) {...
  8. JohnLucania

    pod format

    ...Perl code under mod_perl. =head1 Maintainers Maintainer is the person(s) you should contact with updates,corrections and patches. =over =item * Stas Bekman E<lt>stas (at) stason.orgE<gt> =back =head1 Authors =over =item * Stas Bekman E<lt>stas (at) stason.orgE<gt> =back Only the...
  9. JohnLucania

    Can't modify constant item in scalar assignment

    I got it. Thanks a bunch! jl
  10. JohnLucania

    Can't modify constant item in scalar assignment

    What is this error about and how to fix? Can't modify constant item in scalar assignment at line 16, near "}" #! /usr/bin/perl use strict; use warnings; package Protein; our %attrib; sub new { my( $class , %attribs ) = ( @_ ); my $obj = { _name =...
  11. JohnLucania

    Inserting data

    How do you parse the data (Seq.txt) into a table in mysql? The txt data look like: >AREDD7|Mus musculus|brain|45545|411|741 aagcggccggtctgcagtcggagacttgcaggcagcaaacacggtgcgaacgaaccggag gggggagagagaaatcaaacagctaagcgtggagcagacggcctgggacccagaagggga tcgatgcgaggagcgcaataata...
  12. JohnLucania

    passing to query

    ok, I got it working. :-) jl
  13. JohnLucania

    passing to query

    ...my $TISSUE_NAME=$q->param('TISSUE_NAME'); my $dc = DBI->connect ( "DBI:mysql:host=localhost;database=seqdb", "seqdb", "*********", { PrintError => 0 , RaiseError => 1 } ); my $qs = 'SELECT GENE.GENE_NAME, ORGANISM.ORGANISM_NAME, MRNA.MRNA_EXPRESSION_LEVEL...
  14. JohnLucania

    passing to query

    ...my $TISSUE_NAME=$q->param('TISSUE_NAME'); my $dc = DBI->connect ( "DBI:mysql:host=localhost;database=seqdb", "seqdb", "*******", { PrintError => 0 , RaiseError => 1 } ); my $qs = 'SELECT GENE.GENE_NAME, ORGANISM.ORGANISM_NAME, MRNA.MRNA_EXPRESSI ON_LEVEL...
  15. JohnLucania

    passing to query

    bla... $qe->finish; $dc->disconnect (); // I am trying to populate the form right below the result display so that you can run the query right on the page w/o going back to the previous page. // ./SearchSeqResult.cgi >/dev/null retruns no error, but no form shows up on the result...
  16. JohnLucania

    passing to query

    Chris, This takes care of the issue. Thanks a bunch.. jl
  17. JohnLucania

    passing to query

    I removed these extra: my $method = 'post'; my $action = 'SearchSeqResult.cgi';
  18. JohnLucania

    passing to query

    ...my $TISSUE_NAME=$q->param('TISSUE_NAME'); my $dc = DBI->connect ( "DBI:mysql:host=localhost;database=seqdb", "seqdb", "**********", { PrintError => 0 , RaiseError => 1 } ); my $qs = 'SELECT GENE.GENE_NAME, ORGANISM.ORGANISM_NAME, MRNA.MRNA_EXPRESSION_LEVEL...
  19. JohnLucania

    passing to query

    KevinADC, yes, that part works well. Thanks a bunch!! jl
  20. JohnLucania

    passing to query

    ./SearchSeqResult.cgi > /dev/null returns no error, but when I run the cgi pages, I get: Internal Server Error The server encountered an internal error or misconfiguration and was unable to complete your request. Why is that? Thanks, jl

Part and Inventory Search

Back
Top