Can't modify constant item in scalar assignment 2

[JohnLucania]

What is this error about and how to fix?

Can't modify constant item in scalar assignment at line 16, near "}"


#! /usr/bin/perl

use strict;
use warnings;

package Protein;

our %attrib;

sub new {
my( $class , %attribs ) = ( @_ );
my $obj = {
_name = $attrib{name} || die "need 'name'!",
_manu = $attrib{manufacturer} || die "need 'manufacturer'!",
_seq = $attrib{sequence} || die "need 'sequence'!",
};
return bless $obj , $class;
}

my $prot = Protein->new(
name => 'BsrDI',
manufacturer => 'Boehringer Mannheim',
sequence => 'GGCCTACCCTGGGTAAGGGCCTGGAGCAGGA',
);

sub get_name {
my( $self ) = ( @_ );
return $self->{_name};
}
sub get_manu {
my( $self ) = ( @_ );
return $self->{_manu};
}
sub get_seq {
my( $self ) = ( @_ );
return $self->{_seq};
}

my $name = $prot->get_name;
my $manufacturer = $prot->get_manu;
my $sequence = $prot->get_seq;

print $name;
print $manufacturer;
print $sequence;

print "\n";

 

[dmazzini]

Hi

You are changing a constant

_name

you should use $name.....

dmazzini
GSM System and Telecomm Consultant

 

[ishnid]

Try using the `=>' operator instead of `=' when setting up your hash. `=' is the assignment operator, so you're trying to assign a value to _name, which isn't a variable.

 

[JohnLucania]

I got it.
Thanks a bunch!

jl