Loop Problem 2

[torstens]

I'm trying perl for the first time and I just can't seem to get loops to work, I've copied a loop from O'Reilly's "Learning Perl" that doesn't work for me. I'm running active perl on a windows xp system...

#!usr/bin/perl

#right out of O'Reilly's "Learning Perl"

my $some_other = "I dream of betty rubble.";

if ($some_other =~ /\brub/) {
print "Aye, there's the rub.\n;
}

<STDIN>; #so that the window stays open

 

[brigmar]

You're missing the closing quote from your print statement.

 

[torstens]

Thanks much, let me rephrase this code...

I'm trying perl for the first time and I just can't seem to get loops to work. What's wrong with this? I thought it should place whatever the =~ finds into the @results. Any help is appreciated.


sequence = "ATGCATGCTAGTAGCTGATGCTGTAGCACATCAACGATGC"

while (@sequence =~ /CAT(.*?)GCT/) {

push @results, $1;

}

print @results;



<STDIN>;

 

[torstens]

Sorry for all the updates...

I'm trying perl for the first time and I just can't seem to get loops to work. What's wrong with this? I thought it should place whatever the =~ finds into the @results, but nothing is returned. Any help is appreciated.


$sequence = "ATGCATGCTAGTAGCTGATGCTGTAGCACATCAACGATGC";

while ($sequence =~ /CAT(.*?)GCT/) {

push @results, $1;

}

print @results;



<STDIN>;

 

[ishnid]

sequence" shouldn't be an array: it should be a scalar:

my $sequence = "ATGCATGCTAGTAGCTGATGCTGTAGCACATCAACGATGC"

while ($sequence =~ /CAT(.*?)GCT/) {

   push @results, $1;

}

print @results;



<STDIN>;

 

[ishnid]

There are other errors too: you're missing a semicolon from the line where you define $sequence. Also, the regexp should probably have a /g at the end of it.

Are you sure $sequence is as given in the book? As far as I can tell, your regexp will only match one part of the string (and at that point, $1 will be an empty string).

 

[brigmar]

Your regexp needs the /g modifier to run in a while loop, otherwise it's just re-evaluating the rexexp from scratch... ie.. it's ALWAYS true (endless loop, followed by possible out of memory error) or ALWAYS false (empty array).

.. the regexp would be /CAT(.*?)GCT/g

 

[torstens]

Thanks for the help, now I'm trying to get the array to print a list, but it isn't working. Any ideas as far as what I'm doing wrong?

$sequence = AAA1TTT2AAA3TTT4AAA5TTT6AAA7TTT8AAA9TTT;

while ($sequence =~ /AAA(.*?)TTT/g) {

push @results, $1 \n;

}

foreach $results (@results) {
$results .= "\n";
}


print @results;

<STDIN>;

 

[ishnid]

Not sure what you mean by "print a list" - can you elaborate on what's happening that you're not expecting, and what you're expecting to happen that isn't happening?

BTW you're still declaring your $sequence scalar incorrectly: you need quotes around the string.

 

[KevinADC]

sequence = 'AAA1TTT2AAA3TTT4AAA5TTT6AAA7TTT8AAA9TTT'; 
 
@results = $sequence =~ /AAA(.*?)TTT/g; 
$_.="\n" for @results; 
print @results;

- Kevin, perl coder unexceptional!

 

[brigmar]

You need quotes around both the string sequence and around the value that you are pushing to the @results array (since it contains a newline (\n) character:

$sequence = "AAA1TTT2AAA3TTT4AAA5TTT6AAA7TTT8AAA9TTT";

while ($sequence =~ /AAA(.*?)TTT/g) {
  push @results, "$1\n";
}

print @results;

<STDIN>;

Now, because there is only one command in the while construct, it can be re-written to be a little more 'natural language' readable:

$sequence = "AAA1TTT2AAA3TTT4AAA5TTT6AAA7TTT8AAA9TTT";

push @results, "$1\n" while ($sequence =~ /AAA(.*?)TTT/g);

print @results;

<STDIN>;

 

[torstens]

Now what if I was drawing the sequence data from a sting of text from a text file. After I place it into a string, how would I make it a scalar. aka, essentially placing single quotes on each side? Should I be more detailed?

 

[KevinADC]

open(FILE,"yourfile.txt") or die "can't open the file: $!";
while (my $sequence = <FILE>) {
   #do something here with $sequence
}
close(FILE);

- Kevin, perl coder unexceptional!