Search results for query: *

It is not for coursework. Also, I've found a way to do it (sort of), but now it prints out my data four times, and I don't see where the bug is. Again, any help is greatly appreciated. use Data::Dumper; ########################################## # Load Sequence...

Sorry bout posting this in another post, but replying didn't work. I fixed the first problem, but now I don't know how to access the hashes within hashes. How could I get a list for each amino acid that goes like... and this is for research, but not the programing part Thanks for any help...

Hello all, I'm creating a program that takes a DNA sequence, goes through it codon by codon, counting the number of codons for each amino acid. Here's the code (It's long, but simple and I'd really appreciate any help I can get) [the output is after it, essentially it isn't counting]...

How would I concatenate the values of this hash so that rather than an array I would have a single scalar sequence?

I wish I could give you more than one star for that. Thanks Miller H

it would be split into multiple lines

I want to parse a FASTA-like file into a hash (without using bioperl). The file I'm working with is similar to... >TTHERM_01213980 ATGGAGTAGATTTAATAAGACTAATAAGGATTGATTTCATGGTACTGTTATAATGCATAA >TTHERM_00697570 ATGAATAAATATACTCTAATTACTTTAGGAGTTTGTATGCTTATAGTTAATGGGTTTTTG...

I am trying to count the occurences of a given base in a sequence. The problem I'm running into is with this code: $count = ($Sequence =~ tr/$base//); where the $base variable is the given base to count. The code works perfectly if I manually replace $base with a given base, but otherwise...

I'm looking for a way for perl to read in all the files (these would contain DNA sequence data) in a folder that the user inputs. Essentially my question is, how can the user pinpoint a folder for perl to examine that is in just some odd location?

I was wondering about how one could use the get command on an array of URLs via LWP::Simple. I'm just filtering the code so it doesn't matter if all the source from all of the URLS is dumped into one scalar variable. essentially, how can I make this work... @array =...

how bout if I want to populate a list of 100. Meaning, I want 100 urls following the pattern above.

I'm trying to create a search by constructing the resulting url(s). In order to do so I have a base url string $url = blah.com/sassafras% this would be the first page, and the subsequent search pages would be... blah.com/sassafras%&ct=11 blah.com/sassafras%&ct=21 blah.com/sassafras%&ct=31...

Is that module included in the basic perl install? On a related question, where can I go to find what modules are included with the basic install?

To take resources from someone elses website and download them onto my computer.

I was wondering, as the title says, if its possible to download videos from the web with perl. Be they .mov, .mpeg, .avi...

Thanks a lot, It helps to have the complex and the simple problems explained. The final program I made is tweeked just a bit, but it gets the point across that you can have permanence. Just for the completeness of this post I'm including it below. use Storable qw(store retrieve freeze thaw...

What am I doing wrong? I'm playing with Storable, and I was hoping to create an array (@test) which I retrieve from a file, then push another array (@addon) onto it, and then resave it. The hope is that every time I start this program I'll get... first first first added added and the next...

Thanks for the tip. A couple of questions: I don't see where I actually download it from that page. Also, do you (or anyone reading this) have any experience with the other "Storable" modules found on cpan.org. There are a couple of newer ones written by a couple of different people. Are...

I'm wondering how the people of this community will save their hash variables for permanent use. I've saved my arrays to text files pretty well, but I don't know how I would go about printing a hash to a text file, closing the programs, and later extracting the saved hash text back into a hash...

I'm quite new to this, and am hoping for a little explanation. I'm trying to get the final (duplicate free) array and then print it into a text file. I tried altering your code just a bit, but it still throws in the duplicates. my %hash = (); unless (@AJmasterNAMES =~ /$AJsearch/g) {...