parsing into a hash sans bioperl 1

[torstens]

I want to parse a FASTA-like file into a hash (without using bioperl). The file I'm working with is similar to...

>TTHERM_01213980
ATGGAGTAGATTTAATAAGACTAATAAGGATTGATTTCATGGTACTGTTATAATGCATAA

>TTHERM_00697570
ATGAATAAATATACTCTAATTACTTTAGGAGTTTGTATGCTTATAGTTAATGGGTTTTTG
AATAAGCATACCTTTTAATTATCTAACCACTAAACTGGCTTTGATTTATCTCTGTGTGCC

but the sequences are very long, and there are 40+ of them. I want the key to be the name (i.e. TTHERM_01213980) and the content to be the sequence, all of them in one hash.
I've come up with some ways of trying them, but I won't even try writing them because they're long, and don't work.
I appreciate any help I can get.

Thanks

 

[travs69]

Is the data all on one line or split into multiple lines like the second example above?

 

[torstens]

it would be split into multiple lines

 

[MillerH]

open FILE, 'data.txt' or die "Can't open data.txt: $!";

my %hash;
my $key = '';
while (<FILE>) {
	chomp;
	next if /^\s*$/;
	
	if (/^>\s*(\w+)/) {
		die "Duplicate Key Found: $1\n"  if exists $hash{$1};
		$key = $1;
		$hash{$key} = [];
		next;
	}
	
	if ($key eq '') {
		die "Data Found before a key\n";
	}
	
	push @{$hash{$key}}, $_;
}

close FILE;

Enjoy,
- Miller

 

[torstens]

I wish I could give you more than one star for that. Thanks Miller H

 

[torstens]

How would I concatenate the values of this hash so that rather than an array I would have a single scalar sequence?

 

[MillerH]

Change the two lines doing array operations to string operations:

$hash{$key} = [];

to

$hash{$key} = '';

and

push @{$hash{$key}}, $_;

to

$hash{$key}} .= $_;

- Miller