Tek-Tips is the largest IT community on the Internet today!
Members share and learn making Tek-Tips Forums the best source of peer-reviewed technical information on the Internet!
-
Congratulations John Tel on being selected by the Tek-Tips community for having the most helpful posts in the forums last week. Way to Go!
-
Accessing Hash Data
Sorry bout posting this in another post, but replying didn't work. I fixed the first problem, but now I don't know how to access the hashes within hashes. How could I get a list for each amino acid that goes like... and this is for research, but not the programing part Thanks for any help... -
Problems with my hash
Hello all, I'm creating a program that takes a DNA sequence, goes through it codon by codon, counting the number of codons for each amino acid. Here's the code (It's long, but simple and I'd really appreciate any help I can get) [the output is after it, essentially it isn't counting]... -
parsing into a hash sans bioperl
I want to parse a FASTA-like file into a hash (without using bioperl). The file I'm working with is similar to... >TTHERM_01213980 ATGGAGTAGATTTAATAAGACTAATAAGGATTGATTTCATGGTACTGTTATAATGCATAA >TTHERM_00697570 ATGAATAAATATACTCTAATTACTTTAGGAGTTTGTATGCTTATAGTTAATGGGTTTTTG... -
tr function with a variable, bioinformatics
I am trying to count the occurences of a given base in a sequence. The problem I'm running into is with this code: $count = ($Sequence =~ tr/$base//); where the $base variable is the given base to count. The code works perfectly if I manually replace $base with a given base, but otherwise... -
Finding a folder/file
I'm looking for a way for perl to read in all the files (these would contain DNA sequence data) in a folder that the user inputs. Essentially my question is, how can the user pinpoint a folder for perl to examine that is in just some odd location? -
LWP::Simple and Array of URLS
I was wondering about how one could use the get command on an array of URLs via LWP::Simple. I'm just filtering the code so it doesn't matter if all the source from all of the URLS is dumped into one scalar variable. essentially, how can I make this work... @array =... -
creating a list of url's with one changing variable
I'm trying to create a search by constructing the resulting url(s). In order to do so I have a base url string $url = blah.com/sassafras% this would be the first page, and the subsequent search pages would be... blah.com/sassafras%&ct=11 blah.com/sassafras%&ct=21 blah.com/sassafras%&ct=31... -
Is it possible to download videos?
I was wondering, as the title says, if its possible to download videos from the web with perl. Be they .mov, .mpeg, .avi... -
Saving hashes for later use
I'm wondering how the people of this community will save their hash variables for permanent use. I've saved my arrays to text files pretty well, but I don't know how I would go about printing a hash to a text file, closing the programs, and later extracting the saved hash text back into a hash... -
Preventing duplicate array values
I'm taking in search values to make up a file system. When I take the $search in I want to add that to an array. The problem is when I want to only add it if it is not already present. Right now it just keeps on adding it to the array rather than only if it is new. Any help is appreciated... -
Loop Problem
I'm trying perl for the first time and I just can't seem to get loops to work, I've copied a loop from O'Reilly's "Learning Perl" that doesn't work for me. I'm running active perl on a windows xp system... #!usr/bin/perl #right out of O'Reilly's "Learning Perl" my $some_other = "I dream of...
