Search results for query: *

while ( my @rids = $fac->each_rid ) { die "No record found\n" unless @rids; foreach my $rid ( @rids ) { my $result = $fac->retrieve_blast( $rid ); if( ref( $result )) { my $output = $result->next_result(); my $filename = $output->query_name().".out"; $filename...

What is the recommened/common pod format/template in practice? Of course, they will vary, but in general? I have an example: =pod =head1 NAME Debugging mod_perl Perl Internals =head1 Description This document explains how to debug Perl code under mod_perl. =head1 Maintainers Maintainer...

What is this error about and how to fix? Can't modify constant item in scalar assignment at line 16, near "}" #! /usr/bin/perl use strict; use warnings; package Protein; our %attrib; sub new { my( $class , %attribs ) = ( @_ ); my $obj = { _name =...

How do you parse the data (Seq.txt) into a table in mysql? The txt data look like: >AREDD7|Mus musculus|brain|45545|411|741 aagcggccggtctgcagtcggagacttgcaggcagcaaacacggtgcgaacgaaccggag gggggagagagaaatcaaacagctaagcgtggagcagacggcctgggacccagaagggga tcgatgcgaggagcgcaataata...

I have a form: <form name="SearchSeq" method="post" action="SearchSeqResult.cgi"> <p><b>GENE NAME:</b> <select name="GENE_NAME"> <option>BRC2_HUMAN</option> bla..... </select> </p> <p><b>ORGANISM NAME:</b> <select...

I have a form: #! /usr/bin/perl use warnings; use strict; use CGI ( ':standard' ); my $title = 'Sequence Search'; my $seq = param( 'Seq' ); print header, start_html( $title ), h1( $title ),<<"PrintTag",end_html; <form name="SearchSeq" method="post" action="SearchSeqResult.cgi"> <p>...

use DBI; ........... print "Enter the Gene Name: \n"; $ARGV[0] = <STDIN>; print "Enter the organism: \n"; $ARGV[1] = <STDIN>; print "Enter the exp level: \n"; $ARGV[2] = <STDIN>; .............. my $st = "SELECT GENE.GENE_NAME, ORGANISM.ORGANISM_NAME, MRNA.MRNA_EXPRESSION_LEVEL"; $st .=...

use Test::Simple tests print "Enter sequences: "; chomp(@CheckChar= <STDIN>); // when ‘abd’ (please note ‘ ‘) is entered, it gives me. ok( grep(/abd|ABD/i, @CheckChar), "A word, 'abd', checks" ); ok 1 - A word, 'abd', checks // when abd (please note w/o ‘ ‘) is entered, it gives me ‘Failed...

sub CheckSeq { return scalar grep /[^abceABCE]/, @CheckChar; } For this, I tried both below. What is wrong with it? ok( @CheckChar =~ /[^abceABCE]*@/, "sequence composition checks" ); ok( @CheckChar =~ /[^abceABCE]/, "sequence composition checks" ); grep(/abd|ABD/i, @CheckChar ); Also, how...

How do you put die () in this case? if !CheckSeq (); then, sub 2nd and sub 3rd don’t need to be called and don’t need to print. sub CheckSeq { return scalar grep /[abceABDE]/, @SeqChar; } sub 2nd{ } sub 3rd { } print "1. Your input contains valid sequence.\n" if CheckSeq ()...

I put this in a modue. sub trans { my %translate = ( 'uvx' => 'asn', 'uxx' => 'cya', 'yyu' => 'tis', 'xvu' => 'lis' ); for( @SeqChar ){ tr/abce/uvxy/; s/(...)/$translate{$1}/g; print $_,"\n"; } } trans(); 1; How do you get the acutal...

my @SeqChar; print "Enter sequences and 'enter' and then Ctrl + D: "; chomp(@SeqChar = <STDIN>); sub trans { my %translate = ( 'aug' => 'asn', 'uag' => 'cya', 'gcu' => 'tis', 'aag' => 'lis', 'atg' => 'phe' ); for( @SeqChar ){ tr/atcg/uagc/...

chomp(@SeqChar = <STDIN>) sub trans { map {tr/abce/uvxy/, print "$_\n"} @SeqChar; } How do you get the strings translated from 'sub trans' and print the corresponding strings on the screen? i.e. if the strings translated are 'uvx' then print 'asn' on the screen if the strings translated...

chomp(@SeqChar = <STDIN>) will have hundreds of input strings of qw/abce/ How do you convert all of the inputs like below? a -> u b -> v c -> x e -> y

#! /usr/bin/perl use strict; use warnings; my @SeqChar; print "Enter sequences and 'enter' and then Ctrl + D: "; chomp(@SeqChar = <STDIN>); sub StartChar { my $abc; $abc+= /(abc|ABC)/g for @SeqChar; return $abc } print "\n"; print "Yes, your input contains a seq char (abc).\n" if...

#! /usr/bin/perl use strict; use warnings; my @SeqChar; chomp(@SeqChar = <STDIN>); sub is_invalid_list { return scalar grep /[^a-dA-D]/, @SeqChar; } print "Yes\n" if is_invalid_list( qw/yes daad cab/ ); Why is it not returning anything? jl

#! /usr/bin/perl use strict; use warnings; my @ArrayNum = (1,2,3,4,5,6,7,8,9); How do you display the numbers in matrix like below? matrix 1) 1 2 3 4 5 6 7 8 9 matrix 2) 1 4 7 2 5 8 3 6 9 jl

#! /usr/bin/perl use warnings; use strict; my @array = (1 .. 100); sub NumAscOrder { @array = sort {$a <=> $b} (@array); print "@array\n"; } sub NumDescOrder { @array = sort {$b <=> $a} (@array); print "@array\n"; } print "From largest to smallest: \n"; print...

#! /usr/bin/perl use warnings; use strict; use CGI (':standard'); my $title = '1000 Sequences'; print header, start_html( $title ), h1( $title ); sub random_dna { my $length = shift; my @charlist = ( 'A' , 'C' , 'T', 'G' ); my $random; $random .= $charlist[ int rand(...

I am seeing two issues: 1) the 1st entry doesn't get any regexp checked. Enter Number: 100 2) regexps are not matching correctly. Enter Number or 'exit' to exit: 100 100 is a whole number 100 is an integer 100 is a +/- integer 100 is a real number 100 is a decimal number 100 a C float Enter...